Fig. 2From: Single nucleotide polymorphism rs13042395 in the SLC52A3 gene as a biomarker for regional lymph node metastasis and relapse-free survival of esophageal squamous cell carcinoma patientsPromoter activity of rs13042395 polymorphisms in the SLC52A3 gene in ESCC cells. a Luciferase reporter activity of the SLC52A3 rs13042395 locus in KYSE150 and KYSE180 cells. Constructions of pGLP-V, pGLP-C or pGLP-T were co-transfected into the cells with pRL-TK in the indicated amounts. The empty vector pGLP-V was used as a control. Firefly luciferase activity was normalized to Renilla luciferase activity of the internal control. The experiments were repeated three times. Error bars indicate 95 % confidence intervals, one asterisk indicates statistical significance with P < 0.05, two asterisks indicate statistical significance with P < 0.01. Statistical significance was determined by two-sided one-way analysis of variance along with the Bonferroni post hoc test. b Electrophoretic mobility shift assay analysis of specific interaction between nuclear proteins and the rs13042395 site of SLC52A3. The nuclear protein was extracted from KYSE150 cells. Three micrograms of extract were incubated with a biotin end-labeled oligonucleotide GGCCAGTGCACCGTCATTGTGTGGGCTGGG (CC probes, lanes 1 through 4) or GGCCAGTGCACCGTTATTGTGTGGGCTGGG (TT probes, lanes 5 through 8) in the rs13042395 site. Binding specificity was confirmed by chasing labeled CC or TT probes with a 200-fold molar excess of unlabeled CC (lane 4) or TT probe (lane 7). Labeled probes free of nuclear extracts migrated as shown in lanes1 and 4. Four shift bands presented in lane 2 (CC polymorphism), but only two in lane 6 (TT polymorphism)Back to article page