Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Real-Time qPCR and Methylation-Specific PCR primers

From: CD80 down-regulation is associated to aberrant DNA methylation in non-inflammatory colon carcinogenesis

Real-Time qPCR primers
Gene NCBI ref seq Sequence 5'-- > 3' Ta, °C Amplicon, bp
Actb NM_001101 fw CTGGACTTCGAGCAAGAGATG 60 180
   rv AGTTGAAGGTAGTTTCGTGGATG   
Cd80 NM_005191 fw CTCACTTCTGTTCAGGTGTTATCCA 62 121
   rv TCCTTTTGCCAGTAGATGCGA   
Dnmt1 NM_001130823 fw TACCTGGACGACCCTGACCTC 60 103
   rv CGTTGGCATCAAAGATGGACA   
Dnmt3a NM_175629 fw GACAAGAATGCCACCAAAGC 60 190
   rv CGTCTCCGAACCACATGAC   
Dnmt3b NM_006892 fw GGCAAGTTCTCCGAGGTCTCTG 60 113
   rv TGGTACATGGCTTTTCGATAGGA   
Methylation specific PCR primers
Gene sequence 5'-- > 3' Ta,°C Amplicon, bp
CDH13 meth Fw TCGCGGGGTTCGTTTTTCGC 66 243
Rv GACGTTTTCATTCATACACGCG   
CDH13 unmeth Fw TTGTGGGGTTGTTTTTTGT 55 242
Rv AACTTTTCATTCATACACACA   
APC meth Fw TATTGCGGAGTGCGGGTC 64 98
Rv TCGACGAACTCCCGACGA   
APC unmeth Fw GTGTTTTATTGTGGAGTGTGGGTT 62 108
Rv CCAATCAACAAACTCCCAACAA   
RUNX3 meth Fw TTACGAGGGGCGGTCGTACGCGGG 71 220
Rv AAAACGACCGACGCGAACGCCTCC   
RUNX3 unmeth Fw TTATGAGGGGTGGTTGTATGTGGG 64 220
Rv AAAACAACCAACACAAACACCTCC   
MGMT meth Fw TTTCGACGTTCGTAGGTTTTCGC 64 81
Rv GCACTCTTCCGAAAACGAAACG   
MGMT unmeth Fw TTTGTGTTTTGATGTTTGTAGGTTTTTGT 64 93
Rv AACTCCACACTCTTCCAAAAACAAAACA   
MLH1 meth Fw ACGTAGACGTTTTATTAGGGTCGC 56 115
Rv CCTCATCGTAACTACCCGCG   
MLH1 unmeth Fw TTTTGATGTAGATGTTTTATTAGGGTTGT 56 124
Rv ACCACCTCATCATAACTACCCACA