Skip to main content

Table 1 Sequence of primers used for quantitative real-time PCR

From: Chronic ethanol feeding promotes azoxymethane and dextran sulfate sodium-induced colonic tumorigenesis potentially by enhancing mucosal inflammation

Gene 5′-3′ Sequence
TNF-α Forward: CCCTCACACTCAGATCATCTTCT
Reverse: GCTACGACGTGGGCTACAG
IL- Forward: CGAAGACTACAGTTCTGCCATT
Reverse: GACGTTTCAGAGGTTCTCAGAG
IL-6 Forward: TAGTCCTTCCTACCCCAATTTCC
Reverse: TTGGTCCTTAGCCACTCCTTC
CXCL9/MIG Forward: GGAGTTCGAGGAACCCTAGTG
Reverse: GGGATTTGTAGTGGATCGTGC
CXCL10/IP-10 Forward: CCAAGTGCTGCCGTCATTTTC
Reverse: GGCTCGCAGGGATGATTTCAA
CCL5/RANTES Forward: GCTGCTTTGCCTACCTCTCC
Reverse: TCGAGTGACAAACACGACTGC
IL- Forward: GCAACTGTTCCTGAACTCAACT
Reverse: ATCTTTTGGGGTCCGTCAACT
Ocln Forward: TTGAAAGTCCACCTCCTTACAGA
Reverse: CCGGATAAAAAGAGTACGCTGG
ZO-1 (TJP1) Forward: GCCGCTAAGAGCACAGCAA
Reverse: TCCCCACTCTGAAAATGAGGA
Cldn3 Forward: ACCAACTGCGTACAAGACGAG
Reverse: CAGAGCCGCCAACAGGAAA
GAPDH Forward: CTGCACCACCAACTGCTTAG
Reverse: GGGCCATCCACAGTCTTCT