Skip to main content


Table 2 Characteristics of the primers used for RT-qPCR

From: TGFβ isoforms and receptors mRNA expression in breast tumours: prognostic value and clinical implications

Gene symbol Targeted transcript variants Primer sequences (5′ – 3′) Amplicon (bp)
TGFBR2 NM_001024847, NM_003242 (F): ATGACATCTCGCTGTAATGC 163
GAPDH NM_001256799, NM_002046 (F): TCTCTGCTCCTCCTGTTC 112
  1. F forward primer, R reverse primer, bp base pair