Skip to main content

Table 2 Characteristics of the primers used for RT-qPCR

From: TGFβ isoforms and receptors mRNA expression in breast tumours: prognostic value and clinical implications

Gene symbol Targeted transcript variants Primer sequences (5′ – 3′) Amplicon (bp)
TGFB1 NM_000660 (F): TCGCCAGAGTGGTTATCTT 148
   (R): TAGTGAACCCGTTGATGTCC  
TGFB2 NM_001135599, NM_003238 (F): ACACTCAGCACAGCAGGGTCCT 80
   (R): TTGGGACACGCAGCAAGGAGAAG  
TGFB3 NM_003239 (F): TGAGTGGCTGTTGAGAAGAGA 139
   (R): ATTGTCCACGCCTTTGAATTTGAT  
TGFBR1 NM_001130916, NM_004612 (F): GCAGAGCTGTGAAGCCTTGAGA 128
   (R): TGCCTTCCTGTTGACTGAGTTG  
TGFBR2 NM_001024847, NM_003242 (F): ATGACATCTCGCTGTAATGC 163
   (R): GGATGCCCTGGTGGTTGA  
HPRT1 NM_000194 (F): TGGCGTCGTGATTAGTGATG 160
   (R): GCCTCCCATCTCCTTCATC  
GAPDH NM_001256799, NM_002046 (F): TCTCTGCTCCTCCTGTTC 112
   (R): CGACCAAATCCGTTGACT  
  1. F forward primer, R reverse primer, bp base pair