Skip to main content

Advertisement

Table 1 List of primer sequences

From: Tumorigenic hybrids between mesenchymal stem cells and gastric cancer cells enhanced cancer proliferation, migration and stemness

Genes name Forward primer Tm(°C) Length(bp)
Reverse primer
Oct4 TTGAGGCTCTGCAGCTTAG 60 285
GCCGGTTACAGAACCACAC
Sox2 ACACCAATCCCATCCACACT 60 224
GCAAACTTCCTGCAAAGCTC
Nanog CCTGATTCTTCCACCAGTCC 60 292
TGCTATTCTTCGGCCAGTTG
Lin28 ACCGGACCTGGTGGAGTATT 60 204
CTTCAGCGGACATGAGGCTA
E-cadherin CGCATTGCCACATACACTCT 60 252
TTGGCTGAGGATGGTGTAAG
N-cadherin AGTCAACTGCAACCGTGTCT 60 337
AGCGTTCCTGTTCCACTCAT
vimentin GAGCTGCAGGAGCTGAATG 60 344
AGGTCAAGACGTGCCAGAG
α -SMA CTGACTGAGCGTGGCTATTC 58 452
CCACCGATCCAGACAGAGTA
FAP ATAGCAGTGGCTCCAGTCTC 59 278
GATAAGCCGTGGTTCTGGTC
Slug CCTGGTTGCTTCAAGGACAC 60 395
TCCATGCTCTTGCAGCTCTC
snail GGTTCTTCTGCGCTACTGCT 59 285
TAGGGCTGCTGGAAGGTAAA
twist GTCCGCAGTCTTACGAGGAG 60 294
TGGAGGACCTGGTAGAGGAA
β-actin CACGAAACTACCTTCAACTCC 56 265
CATACTCCTGCTTGCTGATC