Skip to main content

Advertisement

Table 1 Prime sequences for real time PCR (5'- > 3')

From: CA1 contributes to microcalcification and tumourigenesis in breast cancer

  Forward primer Reverse primer
CA1 GCTACAGGCTCTTTCAGTT GACTCCATCCACTGTATGTT
GAPDH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA
AR CCAGGGACCATGTTTTGCC CGAAGACGACAAGATGGACAA
GSTP1 CCCTACACCGTGGTCTATTTCC CAGGAGGCTTTGAGTGAGC
PTGS2 TAAGTGCGATTGTACCCGGAC TTTGTAGCCATAGTCAGCATTGT
SNAI2 TGTGACAAGGAATATGTGAGCC TGAGCCCTCAGATTTGACCTG
XBP1 CCCTCCAGAACATCTCCCCAT ACATGACTGGGTCCAAGTTGT