Skip to main content

Table 1 Primer pairs and conditions used in the PCR to detect H. pylori genes (ureA, cagA and 3’ variable region of the cagA gene that contains EPIYA sequences) and in qRT-PCR to genotype STAT3 rs744166 and to evaluate STAT3 mRNA expression

From: STAT3 polymorphism and Helicobacter pylori CagA strains with higher number of EPIYA-C segments independently increase the risk of gastric cancer

Gene Primers (5’ – 3’) PCR conditions PCR Product (bp) Reference
ureA F: GCCAATGGTAAATTAGTT 95 °C - 5 min.; 34 cycles (94 °C 1 min., 45 °C - 1 min. and 72 °C - 1 min.) and 72 °C - 5 min. 411 34
R: CTCCTTAATTGTTTTTAC
cagA F:CTGCAAAAGATTGTTTGCGAGA 95 °C - 5 min, 34 cycles (95 °C 1 min, 50 °C-1 min and 72 °C-1 min) and 72 °C - 15 min 400 35
R:AGACGGTTTGTTAGAAAACGTC
cagA F:GATAACAGGCAAGCTTTTGAGG 95 °C - 5 min, 38 cycles (94 °C 1 min, 55 °C - 1 min and 72 °C - 2 min.) and 72 °C - 7 min. 349 36
R:CTGCAAAAGATTGTTTGCGAGA
cagA 3’ variable region F: ACCCTAGTCGGTAATGGGTTA 95 °C - 5 min, 35 cycles (95 °C 1 min, 50 °C-1 min and 72 °C-1 min.) and 72 °C - 7 min 500 - 850 37
R: GTAATTGTCTAGTTTCGC
STAT3a Rs744166 CTGTTTGTTCTATAAATTACTGTCA[A/G]GCTCGATTCCCTCAAGACATTACAG 60 °C - 1 min., 95 °C - 10 min., 50 cycles (95 °C - 15 s., 50 °C - 90 s.) and 60 °C - 1 min. 70  
  1. Bp, base pairs; a, Applied Biosystem, HS00374280-m1