Skip to main content

Table 2 Primer sequence of target mRNAs/miRNAs

From: MicroRNA-10a is reduced in breast cancer and regulated in part through retinoic acid

miRNA Gene locus Primer sequence
RARß 3p24.2 Forward: CTCCCTCCCTGCCTAACCA
Reverse: TCCACTGCCTCTTAGCATTTACT
THRα 17q11.2 Forward: TGACCATCGCCGTTAT
Reverse: GCTTTTGTTGGCGTAC
hsa-miR-10a 17q21.32 Forward: GGAGGGGTACCAGAATCCCATTTTGGCCA
Reverse: GGAGGAAGCTTGCGGAGTGTTTATGTCAACT
\