Skip to main content

Table 1 Primers used for quantitative RT-PCR

From: Loss of full length CtBP1 expression enhances the invasive potential of human melanoma

Gene name for rev
AP1S1 GGAGGAGATGGGTTTGGCAT GTGGAGGGAGGGAATGTTTGA
ATP1B1 TGGCTGGCATCTTCATCGGA CTTTCGGTTCACTGGGCACA
CLDN11 TCTGTTGCTCAGGCTGGAGT CGAGGCGGGAGGATACTTTGA
COL1A2 CCCAGCCGGAGATAGAGG TCACCAGGCTCACCAGCAGG
CtBP1 CGACCTCCGATCATGAAC GCTAAAGCTGAAGGGTTCC
ENC1 GCAACTTCCAAACCATCAGGA TCTGGGAGGTAGCAATAGCG
ENPP2 GGAGAGTCGCATTGGGTTGA TGTAGGGAGAGTGTGTGCCA
FAT CCAATGATAATCCACCCGAGTT TAACAACACCCGTCACGC
FSCN1 CCTGGGCGTGTAGTGTAACT CACCACAAGGGTCAGTCCTA
FUS TTCGTTGCTTGCTTGCCTG TGTAACTCTGCTGTCCGTAGG
MLL5 TGGGCTTGTATCTGGTTTCGG CTGGTGTTGGTAAAGGTAGGCTA
SLC26A2 GATTGGTGAGACAGTTGACCG TTGAAAGAAGCCCATCGCTAC
THBS1 ACTGCGTTGGTGATGTAACAG GTGCTCTCCATTGTGGTTGAA
TMED4 TGGGATAAGCAGAAGGAGGTC ATCTCAGGGTAGTTGTTGGCA
VCAN TCAGAACAGCAAGTGGCAGCGA CAACACAAGTGGCTCCATTACGAC