Skip to main content

Table 1 PCR conditions for SMARCB1 mutation screening

From: Rapid detection of SMARCB1 sequence variation using high resolution melting

Exon Primer Amplicon size
bp
Annealing
temperature
5' Exon 1-1 INI1F actgagggcggcctggtcgt
Snf1Rb ccgaaggtcttgctcagcgc
222 65°C
3' Exon 1-2 Snf1Fb ctctgccgccgcaatgatgatg
INI1R cgacacgcccactaggccac
261 64°C
Exon 2 INI12F ctgcgacccttataatgagc
INI12R gcgagtggttttgaaacagg
213 58°C
Exon 3 INI13F accagcagagtgacccagtg
INI13R agagatgccctggccaggaa
195 60°C
Exon 4 INI14F tcgagcctgacagaggtacagtg
INI14R gaatcagcacggagggtgagt
284 60°C
Exon 5 INI15F ttgcatacctagggctccgg
INI15R cacgtaacacacaggggttg
238 60°C
Exon 6 INI16F tggtgcaatctcttggcatc
INI16R tcagtgctccatgatgacac
277 60°C
Exon 7 INI17F tgggctgcaaaagctctaac
INI17R cgctcacacagagaagtctt
312 60°C
Exon 8 INI18F atccactgggtgccagcagt
INI18R tctgcctggaaagccaggtg
313 60°C
Exon 9 INI19F ccctgtagagccttgggaag
INI19R gcctctgtccttgccagaag
200 60°C