Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 1 Forward and reverse primers for the genes analyzed

From: Hypoxia-inducible factor-1 alpha, in association with inflammation, angiogenesis and MYC, is a critical prognostic factor in patients with HCC after surgery

Gene Forward primer Reverse primer
HIF-1α 5'CTGCTGTCTTACTGGTCCTT3' 5'GTCGCTTCTCCA ATTCTTAC3'
COX-2 5'CCATTCAGTTCCCACCATCT3' 5'TCACTGCTGTTGGGTCTCTG3'
MMP7 5'AGATGTGGAGTGCCAGATGT3' 5'TAGACTGCTACCATCCGTCC3'
MMP9 5'GGCGCTCATGTACCCTATGT3' 5'CCTGTGTACACCCACACCTG3'
VEGF 5'ATGAACTTTCTGCTCTCTGG3' 5'TCATCTCTCCTATGTGCTGGC3'
PDGFRA 5'GGGGAAACGATTGTGGTCACC3' 5'CCCGCACCTCTACAACAAAAT3'
MYC 5'AAAGGCCCCCAAGGTAGTTA3' 5'TTTCCGCAACAAGTCCTCTT3'
HPRT 5'CCTGGCGTCGTGATTAGTG3' 5'CAGAGGGCTACAATGTGATGG3'
TBP 5'ACCACTCCACTGTATCCCTCC3' 5'CTGTTCTTCACTCTTGGCTCCT3'