Skip to main content

Table 5 Primers used for Real-time quantitative PCR analysis

From: Identification of novel candidate target genes, including EPHB3, MASP1 and SSTat 3q26.2–q29 in squamous cell carcinoma of the lung

Gene name Chromosome
location
Primer forward Primer reverse
EPHB3 3q27.1 GGGTCAGAACCTTCCCTAAAGTG GTTAAAGATACCCCAAATAAGTACTGCCT
MASP1 3q27.3 CCTTGCAAGATGAGGGAGTTCAG GCCCCTATACTCTTCCTTCCTATGT
SST 3q27.3 TGACCGACTGCGCTTATCATG TCCCGAAGCTCTTGAGAAAACTATC
\