Skip to main content

Table 4 Estimated haplotypes using the WHAP program and all variants identified, for cases and controls combined.

From: Variations in the NBN/NBS1 gene and the risk of breast cancer in non-BRCA1/2French Canadian families with high risk of breast cancer

   Estimated Haplotype Frequencies  
Haplotype SNPs1
10-1-2-3-4-5-6-11-12-13-7-14-15-16-17-18-19-8-20-9-21-22-23-24
Cases Controls Combined p-value2
1 TGGTAGCTCGCGGGCCCTAAATCA 0.481 0.486 0.483 0.92
2 TAGTACCTCGCGGATAACGGTTCA 0.232 0.255 0.244 0.636
3 TGGTAGCCCGCGGGCCCTAAATCA 0.065 0.097 0.078 0.29
4 AGGTAGCTCGCGGGCCCTAAATCA 0.089 0.030 0.052 0.0205
5 TAGTAGCTCGCGGATAACGGTTCA 0.036 0.007 0.022 0.147
6 TGGTAGCTCGCGCGCCCTAAATCA 0.012 0.036 0.021 0.146
7 TAGTACCTCGCGGATAACGGTTGA 0.006 0.037 0.019 0.0403
8 TGGTAGCTCGCGGGCCCTAAATCG 0.019 0.022 0.015 0.846
9 TGGTAGCTCACAGGCCCCAAATCA 0.013 0.000 0.011 0.11
10 TGGTACCTCGCGGGCCCTAAATCA 0.012 0.008 0.010 0.749
11 TGGTAGCTTGCGGGCCCTAAATCA 0.006 0.014 0.008 0.47
12 TGGTAGCTCGCGGACCCTAAATCA 0.006 0.007 0.006 0.897
13 TGGTAGCTTGCGGGCCCTAAATCG 0.011 0.000 0.006 0.126
14 TGGTAGCTCACAGGCCCCAAATCG 0.011 0.008 0.006 0.128
  1. 1SNPs identification as in Table 2 and 3. 2 p-value for haplotype-specific test, each haplotype versus all other haplotypes.