Skip to main content

Table 1 Oligonucleotide primer sequences used for genotyping

From: CYP17, GSTP1, PON1 and GLO1gene polymorphisms as risk factors for breast cancer: an Italian case-control study

Gene Oligonucleotides Sequence
(5'- 3')
Expected amplicon size (bp)
CYP17 230F CATTCGCACTTCTGGAGTC 459
  642R GGCTCTTGGGGTACTTG  
GSTP1 P105F ACCCCAGGGCTCTATGGGAA 176
  P105R TGAGGGCACAAGAAGCCCCT  
PON1 192 PON192F TATTGTTGCTGTGGGACCTGAG 99
  PON192R CACGCTAAACCCAAATACATCTC  
PON1 55 PON55F GAAGAGTGATGTATAGCCCCAG 170
  PON55R TTTAATCCAGAGCTAATGAAAGCC  
GLO1 GLO1F TCAGAGTGTGTGATTTCGTG 700
  GLO1R CATGGTGAGATGGTAAGTGT