Skip to main content

Table 1 Primer sequences for quantitative RT-PCR

From: Gene expression profile of cervical and skin tissues from human papillomavirus type 16 E6 transgenic mice

Gene Title Forward primer 5'-3' Reverse primer 5'-3
TNF receptor superfamily member (Fas) TTGGAAAATCAACCCCAGACA TGGCAGGCTCTCTCCTCTCTT
Baculoviral IAP repeat-containing 5 (Birc5) TCCACTGCCCTACCGAGAAC TGCTCCTCTATCGGGTTGTCA
Caspase 8 (Casp8) GGCAGGCTTCGAGCAACA CGTAGCCATTCCCAGCAGAA
Cyclin E2 (Ccne2) GCTGCCGCCTTATGTCATTT AAGGCACCATCCAGTCTACACA
Cyclin-dependent kinase 4 (Cdk4) TTTCTAAGCGGCCTGGATTTT CCAGCTTGACGGTCCCATTA
Claudin 4 (Cldn4) TCATCGGCAGCAACATCGT TCGTACATCTTGCACTGCATCTG
Gap junction membrane channel protein beta 6 (Gjb6) GCTTCATTTCGAGGCCAACT AGGTAACACAACTCGGCCACAT
Matrix metallopeptidase 11 (Mmp11) TGGAACTCAGGCCAAAAGGT GGGCAAGGCTGTGAGGTATG
Tight junction protein 2 (Tjp2) ATTCTCAAGATCAACGGCACTGT TCAACACCACAAGCTGCAGTT
\