Skip to main content

Table 1 Quantitative RT-PCR primer sequences, amplicon length and annealing temperature

From: Proteomic analysis of differential proteins in pancreatic carcinomas: Effects of MBD1 knock-down by stable RNA interference

Gene Primer sequences Amplicon length Annealing temperature
MBD-1 5' TCTGGTTGCCAAGGTCCAAA 3'
5' ACATCCATCTTCCCTTCCCGA 3'
122bp 61°C
vimentin 5' TGGAAGAGAACTTTGCCGTTG 3'
5' AAGGTGACGAGCCATTTCCTC 3'
101bp 60°C
GRP78 5' CACCAATGACCAGAATCGCCT 3'
5' CAATGCGCTCCTTGAGCTTT 3'
101bp 60°C