Skip to main content

Table 2 Primers, restriction enzymes and fragment lengths for IVS24-9delT, 5557G>A and IVS38-8T>C variants

From: Association of common ATMvariants with familial breast cancer in a South American population

Variant Primer secuence (1) Anealing temperature Restriction enzyme Fragment lengths
IVS24-9delT F 5' ACTAAGCTGCTGGTCTGAAC 3' R 5' GTCCTGGAACAATCTTAAAGC 3' 48°C FnuH I T allele : 176 bp + 24 bp (-T) allele: 199 bp
IVS38-8T>C F 5' ATGGTAATGGCCTAGACTGG 3' R 5' ATCCAAGTTTGCAGGGGTTG 3' 58°C Rsa I T allele: 295 bp + 148 bp C allele: 260 bp + 148 bp + 35 bp
5557G>A F 5' TAATATGTCAACGGGGCATG 3' R 5' ATTTCTCCATGATTCATTTGGAT 3' 52°C Rsa I G allele: 156 bp + 23 bp A allele: 179 bp
  1. (1) Underlined base indicates a mismatch to create the restriction site