Skip to main content

Table 1 Primers used for PCR amplification of the EGFR kinase domain

From: Epidermal growth factor receptor structural alterations in gastric cancer

Exon   Primer Sequence PCR product size (bp)
Exon 18 Forward TGGGCCATGTCTGGCACTGC 283
  Reverse ACAGCTTGCAAGGACTCTGG  
Exon 19 Forward TCACTGGGCAGCATGTGGCA 241
  Reverse CAGCTGCCAGACATGAGAAA  
Exon 20 Forward CCTTCTGGCCACCATGCGAA 295
  Reverse CGCATGTGAGGATCCTGGCT  
Exon 21 Forward ATTCGGATGCAGAGCTTCTT 265
  Reverse CCTGGTGTCAGGAAAATGCT