Skip to main content

Table 1 CYP gene polymorphisms analysed

From: Polymorphisms in the cytochrome P450 genes CYP1A2, CYP1B1, CYP3A4, CYP3A5, CYP11A1, CYP17A1, CYP19A1and colorectal cancer risk

Gene SNP Details Chr Coordinate1 Allele A2B2 Top strand
CYP1A2 rs2069522 within 2kb 5' of mRNA 15 72826286 A G CAGATGGATGGGGAATCCAATAGAG [A/G]AACAGAGCATGTTTGAAGGCCATGA
CYP1B1 rs1800440 coding N453S 2 38209790 A G TTCTTGGACAAGGAHGGCCTCATCA [A/G]CAAGGACCTGACCAGCAGAGTGATG
  rs1056836 coding L432V 2 38209854 C G AAGTTCTCCGGGTTAGGCCACTTCA [C/G]TGGGTCATGATTCACAGACCACTGG
  rs2617266 intronic 2 38214195 A G GGCTGGTGCCCATGCTGGGGACAGA [A/G]AGGAGAAGGCGTGACACTCAGGGGT
  rs2567206 within 2kb 5' of mRNA 2 38215182 A G CGCTTCATCACAGCCACCTCCAATC [A/G]AGGCCGCACGGTGTCCCCAGAACCA
  rs162558 within 2kb 5' of mRNA 2 38215730 A G ACTTCAACCCGATAAAGTTCGCCGG [A/G]GCGCGGAGATTCGCCTCCTCCTGCC
  rs49785885 within 2kb 5' of mRNA 2 38216383 C G TGAGCTCCACTCGCGCTGCGAATCT [C/G]GTGCTATTATTGACCTGTTTACAGA
CYP3A4 rs4986910 coding M445T 7 99003175 A G TTTCATGTTCATGAGAGCAAACCTC [A/G]TGCCAATGCAGTTTCTGGGTCCACT
  rs2242480 intronic 7 99006117 A G TTTTACCCAATAAGGTGAGTGGATG [A/G]TACATGGAGAAGGAGGGAGGAGGTG
  rs2687116 intronic 7 99010594 A C AATAAAGCAGTTATTTTTAAGAGAG [A/C]AAGATAAATAAAAGGAAATAGTAGT
  rs4986907 coding R162Q 7 99012078 A G GATGTGTTGGTGAGAAATCTGAGGC [A/G]GGAAGCAGAGACAGGCAAGCCTGTC
  rs12721636 5' UTR 7 99026417 A C GGAAAGCTCCATGCACATAGCCCAG [A/C]AAAGAGCAACACAGAGCTGAAAGGA
  rs2740574 within 2kb 5' of mRNA 7 99026747 A G GAGGACAGCCATAGAGACAAGGGCA [A/G]GAGAGAGGCGATTTAATAGATTTTA
  rs11773597 within 2kb 5' of mRNA 7 99027102 C G CTGTCATGGCTCTGGTCCCTACCAG [C/G]GTGCTGTACACACAGTGGGCAACTA
CYP3A5 rs15524 3' UTR 7 99083850 A G AGCTTTCTTGAAGACCAAAGTAGAA [A/G]TCCTTAGAATAACTCATTCTCCACT
  ss49785886 coding T398N 7 98894887 A C AAAGGGTCAATGGTGGTGATTCCAA [A/C]TTATGCTCTTCACCATGACCCAAAG
  rs776746 intronic 7 98915190 A G CTTTAAAGAGCTCTTTTGTCTTTCA [A/G]TATCTCTTCCCTGTTTGGACCACAT
CYP11A1 rs2073475 within 2kb 5' of mRNA 15 72448947 A G TGCCCCACAACACTGGGGGAGGTGC [A/G]GAGGCCTGAACGGAAGTTGGGGTGG
CYP17A1 rs743572 5' UTR 10 104587142 A G GGTGCCGGCAGGCAAGATAGACAGC [A/G]GTGGAGTAGAAGAGCTGTGGCAACT
CYP19A1 rs10046 intronic 15 49290278 A G CTACTGATGAGAAATGCTCCAGAGT [A/G]GGTACTGACCAGCCTTCTCTAGTGT
  1. 1Human genome build 35, 2Top strand allele, encoded according to the convention adopted by Illumina, Inc. for strand specific genotype annotation in the absence of a reference genome