Skip to main content

Table 2

From: 3-Phosphoinositide-dependent Protein Kinase-1 (PDK1) promotes invasion and activation of matrix metalloproteinases

Genes Forward primer (5' → 3') Reverse primer (5' → 3')
WDNM1 AGACAGCCACAGTCTTTGTTCTG GATCCATCTCCTGTGCATCGTTC
TIMP3 CCC TTT GGC ACT CTG GTC TA TCC TGT GTA CAT CTT GCC TTC ATA
Lck CAA GAA TCT GAG CCG TTA GGA GGA GAT GTA GAA GCC ACC GTT GT
Collagen VI CCA AAC CCA CGG GAC CTC AAA CTC ACT GGC AAA GCT GTA GAC C
β-Actin AGA GGG AAA TCG TGC GTG AC CAA TAG TGA TGA CCT GGC CGT