Skip to main content

Table 3 Primers used for mRNA amplification by RT-PCR.

From: FGFR1 and WT1 are markers of human prostate cancer progression

TACC1 F: AAATACGAAGAGACCCGGC
  R: TGTCCAGTTTCTCTTCTGCG
WT1 F: ATGAGGATCCCATGGGCCAGCA
  R: CCTGGGACACTGAACGGTCCCCGA
MART1 F: TGACCCTACAAGATGCCAAG
  R: TCAGCATGTCTCAGGTGTCT
Actin F: AGCAAGAGAGGCATCCTGACC
  R: CTTCATGATGGAGTTGAAGGTAG
  1. DNA sequences are listed in a 5'→3' orientation (F and R are the forward and reverse DNA strands, respectively).