Skip to main content


Table 1 Primers for semi-quantitative and quantitative RT-PCR

From: Down-regulation of transcription elogation factor A (SII) like 4 (TCEAL4) in anaplastic thyroid cancer

Gene Forward primer (5'-3') Reverse primer (5'-3')
GAPDH ggaaggtgaaggtcggagt tgggtggaatcatattggaa
TCEAL4 (semi-quantitative-PCR) ctggctcattacctcaaggagta agtggacacagctttcagaattg
TCEAL4 (quantitative-PCR) gaaaaggaggggaaatctcg ggctttctctcgtcttgtgg