Skip to main content

Table 3 Primers and conditions for RT-PCRs.

From: Frequent promoter hypermethylation of RASSF1A and CASP8 in neuroblastoma

Gene Primer forward (5'–3') Primer reverse (5'–3') Size (bp) T (°C) Cycles
RASSF1A TCTGTGGCGACTTCATCTGG TTGGGCAGGTAAAAGGAAGT 424 60 35
NORE1A ATCCAGTTGGACTGCAGTCA GGGATTGTCCACAACCATG 450 60 35
BLU GCTTAGCACACACAACCTGC CCTTGGCAAAACTTGTGAGG 233 67 30
CASP8 AGAGAAGCAGCAGCCTTGAAGG AGACAGTATCCCCGAGGTTTGC 160 60 35
TFR GTCAATGTCCCAAACGTCACCAGA ATTTCGGGAATGCTGAGAAAACAGACAGA 298 60 30