Skip to main content

Table 2 Primers and conditions for MSPs.

From: Frequent promoter hypermethylation of RASSF1A and CASP8 in neuroblastoma

Gene Primer forward (5'–3') Primer reverse (5'–3') Size (bp) T (°C) Cycles
RASSF1A      
- U GAGAGTGTGTTTAGTTTTGTTTTTG CCCATACTTCACTAACTTTAAACAC 183 62 38
- M GAGAGCGCGTTTAGTTTCGTTTTC ACCCGTACTTCGCTAACTTTAAACG 184 58 35
NORE1A      
- U ATTTATATTTGTGTAGATGTTGTTTGGTAT ACTTTAACAACAACAACTTTAACAACTACA 215 54 40
- M CGTCGTTTGGTACGGATTTTATTTTTTTCGGTTC GACAACTTTAACAACGACGACTTTAACGACTACG 202 62 40
BLU      
- U TTTGTGGGTTATAGTTTGAGAAAGTG AACAAATTAACCACACCTACAC 156 60 30
- M TTCGTGGGTTATAGTTCGAGAAAGCG AACGAATTAACCGCGCCTACGC 156 66 30
CASP8      
- U TAGGGGATTTGGAGATTGTGA CCATATATCTACATTCAAAACAA 320 53 40
- M TAGGGGATTCGGAGATTGCGA CGTATATCTACATTCGAAACGA 321 50 40
  1. U: unmethylated; M: methylated.
\