Skip to main content

Advertisement

Table 2 Primers used for RT-PCR

From: Microarray-based identification and RT-PCR test screening for epithelial-specific mRNAs in peripheral blood of patients with colon cancer

Primer Sequence (5' → 3') Direction Nt 5'a Expected size (bp)
PRSS22 ctatcatcgactcggaagtc f 668 676
  gatatgtgggcagggttaca r 1343  
RANBP3 gctcgtacgagtgtagacactgggc f 2195 191
  agggacctcgacagagctgtgcct r 2385  
TMEM69 gatgtctctccagcaaaacttttc f 281 299
  ctggctccataagccatctgag r 579  
B2M gcgggcattcctgaagctgac f 25 586
  tacatcaaacatggagacagcac r 610  
  1. a Nt 5' indicates the position of the nucleotide (Nt) at the 5' end of the primer. [GenBank:AB021288 (B2M), AB010779 (PRSS22), NM_003624 (RANBP3), NM_016486 (TMEM69)]. B2M, β-2 microglobulin; f, forward; r, reverse; bp, base pair.