Skip to main content

Table 2 List of primer sequences used for RT-PCR analysis.

From: Increased therapeutic potential of an experimental anti-mitotic inhibitor SB715992 by genistein in PC-3 human prostate cancer cell line

Genes Forward Primer Sequence Reverse Primer Sequence PCR Product Size
IL11 agctgagggacaaattcc cacacctgggagctgtag 104 b.p.
CDK11 caaacggaaaactggatg caggtgtccttgaatgct 148 b.p.
FRK ccagctccatttgatttg ttatctgtgcctccctca 202 b.p
p15 cacaatggagctagaagca aattccattttcgaagcc 153 b.p.
CHD2 aagggactccaaggaatg aggtttgcatttgtatgctt 192 b.p.
CNOT3 tggaacgagagaccaaaa aatccggtcctgcttatc 218 b.p.
p57 gaccgttcatgtagcagc caccttgggaccagtgta 142 b.p.
ELF3 gagtcggaactgagggtt tgaggaggcaccagataa 286 b.p.
ACVR2B tcgaagtagagctgtggc catgcaggtatgagaggc 138 b.p.
TNFSF15 ccacctattttgtgctgg agatgatccacccacctt 211 b.p.
EGFR gtgctggatgatagacgc attgttgctggttgcact 286 b.p.
p27 tggtgatctcccaagcta aaaactcccaagcacctc 189 b.p.
KRAS2 cagggcgaatttgtaatg gttcagtagggcagctca 229 b.p.
FGF ttgtccttcctcctcctc agggttcctatcagtggc 117 b.p.