Skip to main content

Table 1 Primers and PCR conditions used in BACH1 mutation analysis.

From: BACH1 Ser919Pro variant and breast cancer risk

Exon Strand Primer name Nucleotide sequence (5'→3') Amplicon lenght (bp) Annealing temperature (°C)
2 Forward Ex2F CTGTTTCCAGATTTCTCCC   
  Reverse Ex2R GTGAACCCAGAAAATATTCTCC 331 58
3 Forward Ex3F CCCTGGAGTGCAATCTCACT   
  Reverse Ex3RN TAGCGACAGCATGGCTGAA 319 48
4 Forward Ex4F CCTGGGTGAACTGGGCTGTAG   
  Reverse Ex4RN TAACAGTAATAATTAAGACTC 316 48
5 Forward Ex5FN TTGCCTACCTGTAAGTTATTTATG   
  Reverse Ex5RN ACCATGTTCAGCTGTAACTAACTG 233 60
6 Forward Ex6F GAGCTGTTTTGGCCTTTGAGA   
  Reverse Ex6RN CTGAGTGGGTTGCTACTGTCCT 317 55
7 Forward Ex7F GTTCTGATTCCATGTGAGGTT   
  Reverse Ex7R GTACATATAAAACACATACTGAGT 448 55
8 Forward Ex8F GATGTTCCTCAAATTCTGAGATAA   
  Reverse Ex8R CATCTAAAAGCTTTTACATTCAAC 386 55
9 Forward Ex9F GCCTATAGTGTGAATTTTAAAATG   
  Reverse Ex9R CCTAGTTAACCAAAGTTTACTAAC 395 55
10 Forward Ex10F GATCAACGCATGACAATAATGATG   
  Reverse Ex10R GGGTTACTCACTAGATTTAATCTG 320 55
11 Forward Ex11F GCATGTTTTGTTGGGTTTCATTGT   
  Reverse Ex11R GGTATGTATTAAACACATGCTAGC 326 55
12 Forward Ex12F GTACCAGCTCTTTCAAATGAG   
  Reverse Ex12R CTATCTTTAAAAGAGTCAACCAC 360 55
13 Forward Ex13FN GTGCTGGGATTACAGGTGTGAGCCA   
  Reverse Ex13RN ACTTGCTGGCACTTCAGGTATCTTC 317 60
14 Forward Ex14F CTTGTTGCTTGATCTTTTATGTAC   
  Reverse Ex14R CTAGGAAGCTTACTGTGGTAA 356 55
15 Forward Ex15FN ACAGCTCTATGAGATATATTG   
  Reverse Ex15RN TCATAGGAGAACAAGTACAAT 504 55
16 Forward Ex16FN TTACTTAAAGACATTGAACTT   
  Reverse Ex16RNN CACTATAAAAGCAAAGCGC 392 54
17 Forward Ex17FN CTGTTAGAAGTTAATATGATG   
  Reverse Ex17RN GAATACATACCAGTTCCTATG 325 55
18 Forward Ex18F CCAATTTTCTGTCTGTCCCAC   
  Reverse Ex18R GATAGTAGAGCTCATGTTATGTG 254 55
19 Forward Ex19F CTTCACTAGAAAAAGCAAGTG   
  Reverse Ex19R CCACCATATTTAAGGAATTAATC 523 48
20A Forward Ex20AFN ACCTAGCAATTATGTTAGCT   
  Reverse Ex20ARN TCTGTATCTTCAGGATCGTA 584 48
20B Forward Ex20BFN ATTGATGCCACCCTTACTA   
  Reverse Ex20BRNN TAACATAAGCATGATGACATA 565 54