Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Candidate single nucleotide polymorphisms (SNPs) and their respective probes and primers

From: Interleukin gene polymorphisms and breast cancer: a case control study and systematic literature review

Gene Location SNP ID Forward primer Reverse primer FAM probe TET probe
IL-1A +4845 G>T rs17561 TGCACTTGTGATCATGGTTTTAGA TCCTCATAAAGTTGTATTTCACATTGC CAAGCCTAGGTCATCACCTTTTAGCTTCC AAGCCTAGGTCAGCACCTTTTAGCTTCC
IL-1B -511 C>T rs16944 TTGAGGGTGTGGGTCTCTACCT AGGAGCCTGAACCCTGCATAC TTCTCTGCCTCGGGAGCTCTCTGT TTCTCTGCCTCAGGAGCTCTCTGTCA
IL-1B +3954 C>T rs1143634 GCCTGCCCTTCTGATTTTATACC CATCGTGCACATAAGCCTCGTTA TTCAGAACCTATCTTCTTTGACACATGGGA CAGAACCTATCTTCTTCGACACATGGGA
IL-1RN +2018 T>C rs419598 GGGATGTTAACCAGAAGACCTTCTATCT CAACCACTCACCTTCTAAATTGACATT AACAACCAACTAGTTGCTGGATACTTGCAA ACAACCAACTAGTTGCCGGATACTTGC
IL-4R +1902 A>G rs1801275 AGGCTTGAGAAGGCCTTGTAA CCGAAATGTCCTCCAGCAT CATGTACAAACTCCTGATAGCCACTGGTG CATGTACAAACTCCCGATAGCCACTGG
IL-6 -174 G>C rs1800795 GCTGATTGGAAACCTTATTAAGATTGT AATGACGACCTAAGCTGCACTTT ACGTCCTTTAGCATCGCAAGACACAAC ACGTCCTTTAGCATGGCAAGACACAAC
IL-10 -1082 G>A rs1800896 GATAGGAGGTCCCTTACTTTCCTCTTA CACACACAAATCCAAGACAACACTAC CTACTTCCCCCTCCCAAAGAAGCCT CCTACTTCCCCTTCCCAAAGAAGCC
  1. Note: All sequences are from 5' end to 3' end.