Skip to main content

Table 1 Primers and conditions used for MSP.

From: A phase I study of hydralazine to demethylate and reactivate the expression of tumor suppressor genes

Primer set Sense 5'-- 3' Antisense 5'--- 3' Size Annealing
p16 M TTATTAGAGGGTGGGGCGGATCGC GACCCCGAACCGCGACCGTAA 150 62°C
p16 U TTATTAGAGGGTGGGGTGGATTGT CAACCCCAAACCACAACCATAA 151 62°C
RARβM TCGAGAACGCGAGCGATTCG GACCAATCCAACCGAAACGA 146 55.5°C
RARβU TTGAGAATGTGAGTGATTTGA AACCAATCCAACCAAAACAA 146 55.5°C
MGMT M TTTCGACGTTCGTAGGTTTTCGC AACCAATCCAACCAAAACAA 81 55.7°C
MGMT U TTTGTGTTTTGATGTTTGTAGGTTT AACTCCACACTCTTCCAAAAAC 93 55.7°C
FHIT M TTGGGGCGCGGGTTTGGGTTTTTA CGTAAACGACGCCGACCCCACTA 74 55.5°C
FHIT U TTGGGGTGTGGGTTTGGGTTTTTA CATAAACAACACCAACCCCACTA 74 55.5°C
DAPK M GGATAGTCGGATCGAGTTAACGT CCCTCCCAAACGCCGA 98 55.7°C
DAPK U GGAGGATAGTTGGATTGAGTTAAT CAAATCCCTCCCAAACACCAA 106 55.7°C
APC M TATTGCGGAGTGCGGGTC TCGACGAACTCCCGACGA 100 56°C
APC U GTGTTTTATTGTGGAGTGTGGGTT CCAATCAACAAACTCCCAACAA 110 56°C
GSTp1 M TTCGGGGTGTAGCGGTGGTC GCCCCAATACTAAATCACGACG 91 56°C
GSTp1 U GATGTTTGGGGTGTAGTGGTTGTT CCACCCCAATACTAAATCACAACA 97 56°C
H19 M TTATAAAATCGAAAATTACGCGCGA AGATGATTTTCGTGAATTTTGCG 136 55°C
H19 U TATAATTATAAAATCAAAAATTACA TTTTAGATGATTTTTGTGAATTTT 145 55°C
ER M CGGTTGGAGTTTTTGAATCGTTC CTAGCGTTAACGACGACCG 151 55°C
ER U ATGAGTTGGAGTTTTTGAATTGTTT ATAAACCTACACATTAACAACAACCA 158 55°C
Clone 1.2 M ATGAGTTGGAGTTTTTGAATTGTTT AATAATAAACGTAACGCCCGCGAAC 258 63°C
Clone 1.2 U GGTTGTTTGGTTTTTATTGGGATGTTTTT CCTAAATAATAAACATAACACCCACAAAC 258 63°C