Skip to main content

Table 2 Primer sequences used for RT-PCR.

From: Microarray analysis reveals genetic pathways modulated by tipifarnib in acute myeloid leukemia

Gene Forward Sequence Reverse Sequence
RAC1 CACGATCGAGAAACTGAAGGA AGCAGGCATTTTCTCTTCCTC
TIMP1 TACTTCCACAGGTCCCACAAC GTTTGCAGGGGATGGATAAAC
TGFβR II CAGCGTTTCAAAAAGTGAAGC CTAGACTGGGGTCCAGGTAGG
βGLOGIN GCAACCTCAGACAGACACCAT ACCTTAGGGTTGCCCATAACA
PI3K TGAGCAAGAGGCTTTGGAGTA TTCCTATGCAATCGGTCTTTG
ERK3 GAGCCAGTAGAGGATGGGAAG GATGAGGAATTTGAGGGGAAG
VIMENTIN ATCGATGTGGATGTTTCCAAG TGTCTCCGGTACTCAGTGGAC
FTP ATCCCTTAGCATCAGCTCCTC CGTTCTTTTGGCATTAGTTGG
ADIPSIN CCTGCATCTGGTTGGTCTTTA AGCCTCCTGAGTAGCTGGAAC
EEF1A1 GATGCATTGTTATCATTAACC CATGCAAGTTTGCTGAGCTG