Skip to main content

Table 1 Primer sequences (sense (s) and anti-sense (as)), melting temperatures (Tm), annealing temperature and expected product size in nucleotides (nt) for each of the seven selected marker genes.

From: Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells

Name Sequence 5' – 3' Tm Annealing Size
MUC1 s ACCAAGACTGATGCCAGTAGCACT 65°C   
MUC1 as ACCGTTACCTGCAGAAACCTTCT 63°C 68°C 115 nt
ESX s CTCGGAGCTCCCACTCCTCAGA 68°C   
ESX as GCTCTTCTTGCCCTCGAGACAGT 67°C 68°C 188 nt
CEA s GGTTGGGGTTGCTCTGATATAGCAGC 70°C   
CEA as GCTGTTGCAAATGCTTTAAGGAAGAAGC 67°C 66°C 97 nt
EPHB4 s CCCCAGGGAAGAAGGAGAGCTG 68°C   
EPHB4 as GCCCACGAGCTGGATGACTGTG 68°C 68°C 250 nt
EGFR s TGTGAGGTGGTCCTTGGGAATTTGG 67°C   
EGFR as TGCTGACTATGTCCCGCCACTGGA 69°C 66°C 339 nt
EpCAM s GGACCTGACAGTAAATGGGGAAC 65°C   
EpCAM as CTCTTCTTTCTGGAAATAACCAGCAC 65°C 68°C 186 nt
MGB1 s CGGATGAAACTCTGAGCAATGTTGAG 66°C   
MGB1 as CTGCAGTTCTGTGAGCCAAAGGTC 67°C 68°C 110 nt
  1. Primer sequences (sense (s) and anti-sense (as)), melting temperatures (Tm), annealing temperature and expected product size in nucleotides (nt) for each of the seven selected marker genes. The TM (Salt adjusted) was calculated using the web-based Oligonucleotide Properties calculators http://www.basic.nwu.edu/biotools/oligocalc.html