Skip to main content

Table 6 Forward, reverse primers and probes used for ChIP-qPCR for amplification of the gene promoter region

From: The association between Histone 3 Lysine 27 Trimethylation (H3K27me3) and prostate cancer: relationship with clinicopathological parameters

Genes qPCR primer sequences qPCR MGB Probes (Taqman®)
EZH2 Forward AGTGCAATGGCGCGATCT TCACCGCAACCTC
Reverse GAGGCATGAGAATCGCTTGAA
RAR beta 2 Forward GCACGTAGGCTGTTGGTCTTT CCAGCCCCGAATC
Reversre GCTGGCTTGTCTGTCATAATTCA
PGR Forward GAGCCGCGTGTCACTAAATTG CGTCGCAGCCGCA
Reverse TCACAAGTCCGGCACTTGAG
ER alpha Forward CCCTGACATTGGCTTAAACATCA TCCAGGCACAACTC
Reverse TCTTTGGGATCGCTCCAAAT
RGMA Forward CTGCCAGGTCGGGAGTGT AGAGGAGCAAGTTTG
Reverse CACAGCCATAGGGCCTTCTC
SRC3 Forward AAAATTAAGGGCAGGGCTAGGA TCCGGATCCCGAGGGAGCTCC
Reverse GTGCGGCCGCTTTCG