Skip to main content

Table 2 Sequences of primers used for detection of subtypes of EML4-ALK fusion

From: Non-small cell lung cancer with EML4-ALKtranslocation in Chinese male never-smokers is characterized with early-onset

Forward primers  
Subtypes of fusion Location Sequences
E2-A20 (V5a), E2-ins117-A20 (V5b) EML4-E2 GCTAAAGGCGGCTTTGGCTG
E6-A20 (V3a), E6b-A20 (V3b) EML4-E6 AGTCACATAATTCTTGGGAA
E13-A20 (V1), E13-ins49-A20 (V6) EML4-E13 ATTTGTGCAGTGTTTAGCATTC
E14-ins11-A20 (V4b), E14-del12-A20 (V7) EML4-E14 GGGAAAGGACCTAAAGGTG
E15-A20 (V4a) EML4-E15 GTAGCAGAAGGAAAGGCAGATC
E17-A20, E18-A20 (V9) EML4-E17 CGCTACTCAATAGATGGTACCT
E20-A20 (V2) EML4-E20 CGGGAGACTATGAAATATTGTACT
Common reverse primer ALK-E20 CATGATGGTCGAGGTGCG C
Sequencing primer   TTGCTCAGCTTGTACTCAGGGCTCTG