Skip to main content

Table 1 siRNA nucleotides

From: Expression of miR-34c induces G2/M cell cycle arrest in breast cancer cells

siRNA oligonucleotide Sequence
Control 48% GC UUACGGAUCGACUUAAGCCGUUGCA
CDC23 I GCUGCCCAGUGUUACAUCAAAUAUA
CDC23 II UAUAUUUGAUGUAACACUGGGCAGC
CDC23 III CCAAGCUCGAGAACUUGAUGGAUUU