Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primers for ChIP

From: The transcriptional responsiveness of LKB1 to STAT-mediated signaling is differentially modulated by prolactin in human breast cancer cells

Probe Sequence (5’-3’) Product size
LKB1-GAS-FOR GGACCTACCGATGCCAATTA 184 bp
LKB1-GAS-REV TGGGCAATAAGAGCGAAACT
LKB1-Neg-FOR GAGGACGAAGTTGACCCTGA 208 bp
LKB1-Neg-REV CAACAAAAACCCCAAAAGGA