Skip to main content

Advertisement

Table 3 Primer sequences used for genotyping

From: Epigenetic modulation of the drug resistance genes MGMT, ABCB1 and ABCG2 in glioblastoma multiforme

Gene symbol GenBank accession Forward primer 5′- > 3′ Reverse primer 5′- > 3′ Amplicon size (bp)
MGMT X61657.1 CTAGAACGCTTTGCGTCCCGAC CAACACCTGGGAGGCACTTG 231
ABCB1 AH002875.1 TGTTTTCAGCTGCTTGATGG AAGGCATGTATGTTGGCCTC 197
ABCG2 AH011213.2 TGTTGTGATGGGCACTCTGATG ATCAGAGTCATTTTATCCACAC 222