Skip to main content

Table 1 The primer pairs used in the PCR performing

From: A synthetic dsRNA, as a TLR3 pathwaysynergist, combined with sorafenib suppresses HCC in vitro and in vivo

Number Name Sequence (5′ → 3′)
H-NF-κB* -F GTAGTCCCCACGCTGCTCTTCTATA
  -R GGAGCAGGCTATCAGTCAGCGC
H-TLR3* -F TCCCAGCCTTACAGAGAAGC
  -R CCTGTGAGTTCTTGCCCAAT
H-GAPDH* -F GAAGGTGAAGGTCGGAGTC
  -R GAAGATGGTGATGGGATTC
R-TLR3# -F CGGTCAAGGTGTTCAAGA
  -R GGATGGTAGAAGCGTGTT
R-NF-κB# -F TGGCTTCTATTACCTGTA
  -R TAACGACATATACCATCAG
R- caspase-8# -F TGAACTATGATGTGAGCAATA
  -R TTCCGTAGTGTGAAGATG
R-IFN-γ# -F TCTTCACATCAAAGGAGTCATC
  -R TGCTGCTGGAGGTCATTA
R-β-actin# -F TATGGAATCCTGTGGCATC
  -R GTGTTGGCATAGAGGTCTT
  1. * Primer pairs were designed for human (H) HepG2.2.15 cells; and # Primer pairs designed for rat (R) HCC tissues.