Skip to main content

Table 2 The sequences of primers used for reverse transcription and PCR

From: MicroRNA-21 promotes hepatocellular carcinoma HepG2 cell proliferation through repression of mitogen-activated protein kinase-kinase 3

Application Primer Sequence (5’→3’)
Reverse transcription miR-21 RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCAACATC
U6 RT AACGCTTCACGAATTTGCGT
qRT-PCR of miR-21 Common primer CTCAACTGGTGTCGTGGA
miR-21 PCR ACACTCCAGCTGGCTAGCTTATCAGACTGATG
qRT-PCR of U6 U6 promoter forward CTCGCTTCGGCAGCACA
U6 promoter reverse AACGCTTCACGAATTTGCGT