Skip to main content

Table 1 Primer pairs used for RT-PCR experiment

From: FOXO/TXNIP pathway is involved in the suppression of hepatocellular carcinoma growth by glutamate antagonist MK-801

Gene name   Sequence (5′ → 3′) Genbank accession
NR1: sense TATGGAGAAGCACAACTACGAGAG NM_000832
  antisense CGAGCAGCAGGACCCATCAGTGT  
NR2A sense CGGGTATGATTTCTTCTGGATTGTCCC NM_000833
  antisense GGGTGACGATGCTGAGATGGTTGT  
NR2B sense AGCCCCATCATTCTTCTTTACTGTACCAAG NM_000834
  antisense CCTTTCCCACTTCCTCTCCTTGTTCAG  
NR2C sense CTTTGTGGAGACGGGCATCAGTGT NM_000835
  antisense GGCGAGGAAGATGACAGCAAAGAA  
NR2D sense CCTGCTGCGTGATTATGGTTTCCT NM_000836
  antisense GAGGGCTGTGGGTTCGGTTGA  
NR3A sense CTTTTTAGCAGCCTCCATAGCAGTAATGA NM_133445
  antisense TCATACAGAGTGAGGAAGACGGCAGTG  
NR3B sense GTATCAACTCCGCCCGCTCACAG NM_138690
  antisense AGAGGATGGCGTAGCACAGGTTGA  
β-actin sense CTAACTTGCGCAGAAAACAAGAT NM_001101
  antisense TTCCTGTAACAACGCATCTCATA  
  1. Sequences of the human NMDA receptor subunits were obtained from GENBANK, and PCR primers were designed.