Skip to main content

Advertisement

Table 1 Sequences of primers for remaining human genes

From: Nrf2 is required to maintain the self-renewal of glioma stem cells

Gene Primer sequence
Nrf2 5′TCAGCGACGGAAAGAGTATGA3′(F)
  5′CCACTGGTTTCTGACTGGATGT3′(R)
GAPDH 5′GAAATCCCATCACCATCTTC3′(F)
  5′CCACTGGTTTCTGACTGGATGT3′(R)
BMI-1 5′ TCTAAGGAGGAGGTGAA 3′(F)
  5′ TCTAAGGAGGAGGTGAA 3′(R)
Sox2 5′ CCCCTGTGGTTACCTCTTCCT 3′(F)
  5′ CCGTTAATGGCCGTGCC 3′(R)
Cyclin E 5′ ACCAGTTTGCGTATGTGA 3′(F)
  5′ TGTGGGTCTGTATGTTGTG 3′(R)
GFAP 5′ AGGGACAATCTGGCACAGG 3′(F)
  5′ CGGTAGTCGTTGGCTTCG 3′(R)
HO-1 5′TCTCCGATGGGTCCTTACACTC3′(F)
  5′GGCATAAAGCCCTACAGCAACT3′(R)
NQO1 5′ATGGTCGGCAGAAGAGC3′(F)
  5′GGAAATGATGGGATTGAAGT3′(R)