miRNA name | Mature miRNA sequence | miRBase Accession number | Proposed clinical relevance | Comment | Reference |
---|---|---|---|---|---|
hsa-miR-21 | UAGCUUAUCAGACUGAUGUUGA | MIMAT0000076 | Overall survival | High expression associated with poor OS | [14] |
hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCU | MIMAT0000089 | Tumor stage/ differentiation | High expression associated with advanced tumor stage and poorly differentiated tumors | [10] |
hsa-miR-92a | UAUUGCACUUGUCCCGGCCUGU | MIMAT0000092 | Plasma marker | Elevated levels as a possible diagnostic marker | [13] |
hsa-miR-101 | UACAGUACUGUGAUAACUGAA | MIMAT0000099 | Increased invasiveness | Decreased expression associated with invasiveness | [8] |
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAG | MIMAT0000103 | Disease free and overall survival | Down-regulation associated with poor disease free and overall survival. | [7] |
hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCU | MIMAT0000437 | Tumor size | Low expression associated with large tumor size | [9] |