Skip to main content

Table 2 Primer sets used for quantitative RT-PCR analysis

From: BMP and TGFbeta pathways in human central chondrosarcoma: enhanced endoglin and Smad 1 signaling in high grade tumors

Gene symbol alias forward primer(5'to 3') reverse primer(5'to 3')
BMP2   ACGAGGTCCTGAGCGAGTTC GAAGCTCTGAGGTGATAA
BMP4   CACCTCATCACACGACTAC GGCATGGTTGGTTGAGTTG
BMP6   GAGTCGTAATCGCTCTACCC GTGAACCAAGGTCTGCACAA
BMP7   CCAGAACCGCTCCAAGAC GTTGGTGGCGTTCATGTAG
TGFB1   CAGAAATACAGCAACAATTCC CTGAAGCAATAGTTGGTGTC
TGFB2   CCAAAGGGTACAATGCCAAC CAGATGCTTCTGGATTTATGGTATT
TGFB3   TAAGCGGAATGAGCAGAGG CCACGCCTTTGAATTTGATTT
ACVRL1 ALK1 CTGGACATCGGCAACAAC ACACCACCTTCTTCATGTC
ACVR1 ALK2 TGGCTTCCACGTCTACCA GCGAACACTACAGAGAGAA
BMPR1A ALK3 TATGGAGAAGTATGGATGGG GAACCTGTACCTTTAATGTCT
TGFBR1 ALK5 ATTACCAACTGCCTTATTATGA CATTACTCTCAAGGCTTCAC
BMPR2   TGGGATAGGTGAGAGTAGA GAGGGAGGAGTGGTAGTT
TGFBR2   ATGGAGGCCCAGAAAGATG GACTGCACCGTTGTTGTCAG