Skip to main content

Table 1 Primer sequences used for real-time PCR

From: Effects of EpCAM overexpression on human breast cancer cell lines

Gene GenBank Acc. Nr. sequence (5'to 3')
TBP NM_003194 fwd TGCACAGGAGCCAAGAGTGAA
   rev CACATCACAGCTCCCCACCA
EpCAM NM_002354 fwd CGCAGCTCAGGAAGAATGTG
   rev TGAAGTACACTGGCATTGACG
TCF7L2 NM_030756 fwd TGCACTGTCCAGAGAAGAGC
   rev GCTGCTTGTCCCTTTTCCTC
   fwd TCAATGAATCAGAAACGAATCAA
   rev CTCTTGGCCGCTTCTTCC
SFRP1 NM_003012 fwd GAGTTTGCACTGAGGATGAAAA
   rev GCTTCTTCTTCTTGGGGACA
ITF-2 NM_001083962 fwd AGCCATTCTCTTCTGCCAAA
  NM_003199 rev CAGGTTCTCATCACCCTCGT
CCND1 NM_053056 fwd GCTGCTCCTGGTGAACAAGC
  NM_001758 rev TTCAATGAAATCGTGCGGG
MYC NM_002467 fwd CTACGCAGCGCCTCCCTCCACT
   rev GGCGCTCCAAGACGTTGTGTGTTC