Skip to main content

Table 2 List of primer sequences used for amplification of 14-3-3γ and PI3KR1 genes by Qpcr

From: P53 suppresses expression of the 14-3-3gamma oncogene

  Forward (5' > 3') Reverse (5' > 3') Probe (5' > 3')
14-3-3γ CCTCAGCTGCTCGCTCTG CGGAGAAGGAGGAGGACACT 6-FAM-
CGGTCCTCTCCGGCACTTGGGC-TAMRA
PI3KR1 AAGTCTTAAGTTTGGGTTG
AGTCG
TAATGATTGACCAAGCTTTTA
TGC
6-FAM-
TAATGATTGACCAAGCTTTTATGC-TAMRA