From: Genetic polymorphisms of DNA double strand break gene Ku70 and gastric cancer in Taiwan
Polymorphism (location) | Primers sequences (5' to 3') | Restriction enzyme | SNP sequence | DNA fragment size (bp) |
---|---|---|---|---|
promoter T-991C (rs5751129) | F: AACTCATGGACCCACGGTTGTGA R: CAACTTAAATACAGGAATGTCTTG | Dpn II | T C | 301 200 + 101 |
promoter G-57C (rs2267437) | F: AACTCATGGACCCACGGTTGTGA R: CAACTTAAATACAGGAATGTCTTG | Hae II | C G | 298 195 + 103 |
promoter A-31G (rs132770) | F: TACAGTCCTGACGTAGAAG R: AAGCGACCAACTTGGACAGA | Mnl I | G A | 226 146 + 80 |
intron 3 (rs132774) | F: GTATACTTACTGCATTCTGG R: CATAAGTGCTCAGTACCTAT | Msc I | G C | 160 114 + 46 |