Skip to main content

Table 1 Nucleotide PRIMER sequences and PCR conditions for genotyping by dHPLC or PCR-RFLP

From: Polymorphisms in regulatory regions of Cyclooxygenase-2 gene and breast cancer risk in Brazilians: a case-control study

PRIMER Name Nucleotide sequence Region Identified SNP Number of cycles Melting Temperature Enzyme#
-1290AG F 5' TGCTGTCATTTTCCTGTAATGC 3' PR rs689465 34 60°C PciI
-1195AG R 5' TTTCTCTCCCTGATGCGTGG 3'   rs689466    AluI
AM1* F 5' GCTGTCAAAATCTCCCTTCC 3' PR rs20415 30 58°C  
  R 5' CCACGCATCAGGGAGAGAAA 3'      
AM2* F 5' AACCAAAATAATCCACGC 3' PR   30 63°C  
  R 5' CAAGGAGGGGGTGAAG 3'      
-765GC F 5' CTTTGTCCATCAGAAGGCAGG 3' PR rs20417 35 63°C AciI
  R 5' TAGAGGGTCGAGGAAGTCACG 3'      
AM3* F 5' TTACCTTTCCCGCCTCTC 3' PR rs20419 30 58°C  
  R 5' GCGTCGTCACTAAAACATAAAAC 3'      
AM4* F 5' GCTATGTATGTATGTGCTGC 3' PR   31 55°C  
  R 5' GAACTGGCTCTCGGAAGC 3'      
AM5* F 5' CGGTATCCCATCCAAGGC 3' PR rs5270 31 55°C  
  R 5' CAGTGAGCGTCAGGAGCA 3'   rs20424    
8473TC F 5' CTGTTGCGGAGAAAGGAGTC 3' 3'-UTR rs5275 30 58°C  
  R 5' TCAAACAAGCTTTTACAGGTGA 3'      
9850AG** F 5' CGTTCCCATTCTAATTAATGCCCTT 3' 3'-UTR rs4648298 34 50°C AluI
  R 5' TGTGTCAAGCACTGTGGGTTTTAAT 3'      
10335GA F 5' TTTGGGAAGAGGGAGAAAATGA 3' 3'-UTR rs689469 30 56°C  
  R 5' TATGCGAATGTTTCAGTGCC 3'      
  1. * 15; ** 16; PR: Promoter Region; 3'-UTR: 3';Untranslated Region
  2. # Enzymes used for PCR-RFLP. All other analyses were performed by dHPLC.