Clinical relevance of microRNA miR-21, miR-31, miR-92a, miR-101, miR-106a and miR-145 in colorectal cancer

BMC Cancer

Table 1 Mature sequence, miRBase accession number and proposed clinical relevance for the six chosen miRNAs

miRNA name	Mature miRNA sequence	miRBase Accession number	Proposed clinical relevance	Comment	Reference
hsa-miR-21	UAGCUUAUCAGACUGAUGUUGA	MIMAT0000076	Overall survival	High expression associated with poor OS	[14]
hsa-miR-31	AGGCAAGAUGCUGGCAUAGCU	MIMAT0000089	Tumor stage/ differentiation	High expression associated with advanced tumor stage and poorly differentiated tumors	[10]
hsa-miR-92a	UAUUGCACUUGUCCCGGCCUGU	MIMAT0000092	Plasma marker	Elevated levels as a possible diagnostic marker	[13]
hsa-miR-101	UACAGUACUGUGAUAACUGAA	MIMAT0000099	Increased invasiveness	Decreased expression associated with invasiveness	[8]
hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAG	MIMAT0000103	Disease free and overall survival	Down-regulation associated with poor disease free and overall survival.	[7]
hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCU	MIMAT0000437	Tumor size	Low expression associated with large tumor size	[9]

ISSN: 1471-2407