Skip to main content

Table 2 The primer sequences for RT-qPCR

From: MiR-106b-5p regulates esophageal squamous cell carcinoma progression by binding to HPGD

GENE Primer sequences (5′-3′)
miR-106b-5p Forward: TGCGGCAACACCAGTCGATGG
Reverse: CCAGTGCAGGGTCCGAGGT
U6 Forward: ATTGGAACGATACAGAGAAGATT
Reverse: GGA ACGCTTCACGAATTTG
HPGD Forward: CTCTGTTCATCCAGTGCGAT
Reverse: CTCCCGAGTAAAGGACCCACA
MAL Forward: TCTTTTACCTCAGCGCCTCA
Reverse: CGGCCAGTTAACACCATCTG
GAPDH Forward: AGCCACATCGCTCAGACAC
Reverse: GCCCAATACGACCAAATCC