Skip to main content

Table 2 Primer sequences and their properties used for qPCR

From: The effect of hypoxia on PD-L1 expression in bladder cancer

Primer Sequence Tm (°C) GC-content (%)
PD-L1 forward TATGGTGGTGCCGACTACAA 57.3 50
PD-L1 reverse TGGCTCCCAGAATTACCAAG 57.3 50
SDHA forward CATCCACTACATGACGGAGCA 59.8 52.4
SDHA reverse ATCTTGCCATCTTCAGTTCTGCTA 59.3 41.7