Skip to main content

Table 1 Primers and sequences

From: The genotypic and phenotypic impact of hypoxia microenvironment on glioblastoma cell lines

Name Forward primer (5′- 3′) Reverse Primer (5′- 3′)
miR- 34-5p ACACTCCAGCTGGGTGGCAGTGTCTTAGCT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGACAACC
miR-128-3p ACACTCCAGCTGGGTCACAGTGAACCGGTC CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGAAAGAGAC
miR-221-3p ACACTCCAGCTGGGAGCTACATTGTCTGCT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGGAAACCCA
miR- 17-5p ACACTCCAGCTGGGCAAAGTGCTTACAGTG CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGCTACCTGC
miR-181a-3p ACACTCCAGCTGGGACCATCGACCGUUGAT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGGGTACAAT
miR-181b-5p ACACTCCAGCTGGG- AACATTCATTGCTGTC CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGACCCACCG
miR-181c-5p ACACTCCAGCTGGGAACATTCAACCTGTCG CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGACTCACCG
Universal reverse   CTCAAGTGTCGTGGAGTCGGCAA
SNU6 GCTTCGGCAGCACATATACTAAAAT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGCGTTCCA
Human Actin ATGAAGATCAAG ATCATTGCTCCT ACATCTGCTGGAAGGTGGACA